Review




Structured Review

Synthego Inc sirpα single guide rna
Sirpα Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rna+single+sirp%CE%B1/pm42320470-695-16-19
Average 86 stars, based on 1 article reviews
sirpα single guide rna - by Bioz Stars, 2026-09
86/100 stars

Images

Related Articles

other:

Article Title: Polycomb repression works without Siesta
Article Snippet: For each editing round, 50 picomoles of each single guide RNA (Synthego), were mixed with 60 picomoles of Cas9 nuclease (IDT) and delivered to one million cells by electroporation with Neon Transfection System 10μl kit from ThermoFisher Scientific with 1800V pulse for 10 milliseconds twice according to manufacturer instructions.

Article Title: The DND1–NANOS3 complex shapes the primordial germ cell transcriptome via a heptanucleotide sequence in mRNA 3′ UTRs
Article Snippet: Data from three independently pipetted measurements were analyzed with MO.Affinity Analysis software (NanoTemper Technologies), and K d values were derived using the signal from an MST- on time of 0.5 s. K d values of NANOS3 were determined similarly by measuring the dose response of NANOS3 in the absence or in the presence of 4 μM DND1 protein.

Sequencing:

Article Title: Mutation of a single cysteine in CaMKIIδ protects the heart from ischemia-reperfusion Injury
Article Snippet: .. Briefly, a single guide RNA (sgRNA: AGTGACTTACACAGATCCAT) was purchased from Synthego, and a single-strand oligo donor template was ordered from IDT with this sequence: (GCCAAAGACCTCATCAACAAAATGCTGACCATCAACCCTGCCAAACGTATCACAG CCTCTGAGGC A CTGAAACACCCATGGATC TCC GTAAGTCACTTTCGCATGCACCCC AGGAGCCAAACTGAAGGATAAACCCCTAGTCAC). ..

Article Title: Mechano-osmotic signals control chromatin state and fate transitions in pluripotent stem cells
Article Snippet: Two hours later, 50 ng ml −1 BMP4 (Miltenyi Biotech) was added. .. For YAP1, 0.6 pmol pUC57-Halotag-N-YAP1 plasmid (GenScript; 400 bp/ea homology arms flanking YAP1 ( NM_001130145.3 ) start codon and Halotag coding sequence followed by GGSGGS linker) was mixed with 12.2 pmol Alt-R HiFiCas9 v3 (IDT #1081061) and 17.5 pmol single guide RNA (sgRNA; Synthego,) to transfect 226,000 hiPS cells using Nucleofector 4D 16-well cuvette, 20 μl P3 Primary Cell Nucleofector Solution (Lonza #V4XP-3032), programme CA-137. .. After nucleofection, the hiPS cells were cultured in rhLaminin-521 (Thermo # A29249 )-coated 24-well plates in StemFlex medium (Thermo #A3349401) plus 1 μM HDR enhancer v2 (IDT #10007921) and 1× RevitaCell (Thermo #A2644501) at 32 °C overnight.

CRISPR:

Article Title: Unveiling the cut-and-repair cycle of designer nucleases in human stem and T cells via CLEAR-time dPCR.
Article Snippet: .. SpCas9 or AsCas12a (30 pmol; Integrated DNA Technologies) was complexed with a single guide RNA (225 pmol; Synthego, CRISPR evolution sgRNA EZ Kit) to form a ribonucleoprotein complex (RNP) for 10minutes at room temperature. .. SpCas9 (SpCas9-V3 IDT) or PsCas9 at 4.5μM in the final transfection reaction, and sgRNAs at 1:6.7 Cas9: sgRNA molar ratio were assembled to RNP complexes at room temperature.

Article Title: Unveiling the cut-and-repair cycle of designer nucleases in human stem and T cells via CLEAR-time dPCR
Article Snippet: .. SpCas9 or AsCas12a (30 pmol; Integrated DNA Technologies) was complexed with a single guide RNA (225 pmol; Synthego, CRISPR evolution sgRNA EZ Kit) to form a ribonucleoprotein complex (RNP) for 10 minutes at room temperature. .. SpCas9 (SpCas9-V3 IDT) or PsCas9 at 4.5 μM in the final transfection reaction, and sgRNAs at 1:6.7 Cas9: sgRNA molar ratio were assembled to RNP complexes at room temperature.

Plasmid Preparation:

Article Title: Mechano-osmotic signals control chromatin state and fate transitions in pluripotent stem cells
Article Snippet: Two hours later, 50 ng ml −1 BMP4 (Miltenyi Biotech) was added. .. For YAP1, 0.6 pmol pUC57-Halotag-N-YAP1 plasmid (GenScript; 400 bp/ea homology arms flanking YAP1 ( NM_001130145.3 ) start codon and Halotag coding sequence followed by GGSGGS linker) was mixed with 12.2 pmol Alt-R HiFiCas9 v3 (IDT #1081061) and 17.5 pmol single guide RNA (sgRNA; Synthego,) to transfect 226,000 hiPS cells using Nucleofector 4D 16-well cuvette, 20 μl P3 Primary Cell Nucleofector Solution (Lonza #V4XP-3032), programme CA-137. .. After nucleofection, the hiPS cells were cultured in rhLaminin-521 (Thermo # A29249 )-coated 24-well plates in StemFlex medium (Thermo #A3349401) plus 1 μM HDR enhancer v2 (IDT #10007921) and 1× RevitaCell (Thermo #A2644501) at 32 °C overnight.



Similar Products

86
Synthego Inc sirpα single guide rna
Sirpα Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rna+single+sirp%CE%B1/pm42320470-695-16-19
Average 86 stars, based on 1 article reviews
sirpα single guide rna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc gfp single guide rna
Gfp Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/gfp+guide+rna+single/pm42320470-695-10-13
Average 86 stars, based on 1 article reviews
gfp single guide rna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rna sgrna
Single Guide Rna Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/sgrna/pmc13273111-269-6-22
Average 86 stars, based on 1 article reviews
single guide rna sgrna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc synthetic single guide rnas sgrnas
Synthetic Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rnas/pm42304380-224-0-11
Average 86 stars, based on 1 article reviews
synthetic single guide rnas sgrnas - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc synthetic single guide rna
Synthetic Single Guide Rna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rna+single/pm42259495-57-10-36
Average 86 stars, based on 1 article reviews
synthetic single guide rna - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Benchling Inc optimal single guide rna sgrna target sequences
Optimal Single Guide Rna Sgrna Target Sequences, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rna/pm42167230-305-5-14
Average 86 stars, based on 1 article reviews
optimal single guide rna sgrna target sequences - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Benchling Inc single guide rnas sgrnas
Single Guide Rnas Sgrnas, supplied by Benchling Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/sgrnas/bio_rxiv__64898__2026__05__12__724215-44-0-7
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

86
Synthego Inc single guide rnas sgrnas
Single Guide Rnas Sgrnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/single+guide+rna/guide+rnas+sgrnas+single/pm42129160-1135-0-10
Average 86 stars, based on 1 article reviews
single guide rnas sgrnas - by Bioz Stars, 2026-09
86/100 stars
  Buy from Supplier

Image Search Results